The fungi forming arbuscules in roots of terrestrial plants always created great taxonomic problems, mainly because of difficulties to extract their spores from the soil and to maintain the fungi in living cultures.

Peyronel (1923) first both discovered the regular occurrence of associations of spores and sporocarps of the Endogonaceae with vesicular-arbuscular mycorrhizae of plants and suggested the fungi to be the originators of the mycorrhizae.

The first monograph of the family Endogonaceae Paol. treated in the order Mucorales (Zygomycetes) has been prepared by Thaxter (1922). Fungi of this family were located in four genera producing spores in sporocarps: Endogone Link: Fries, Glaziella Berk., Sclerocystis Berk. & Br., and Sphaerocreas Sacc. & Ellis. In 1935, Zycha transferred the one species of Sphaerocreas to Endogone. The existing genera included both chlamydosporic and zygosporic species. Thaxter (1922) and Godfrey (1957) considered chlamydosporic species to be anamorphs of those producing zygospores, following the finding of both types of spores in sporocarps of Glomus fasciculatum (at that time known as Endogone fasciculata and E. microcarpa).

Many valuable data of the biology of fungi of the family Endogonaceae have been received from their studies in pot cultures. The mode of germination of spores of these fungi, their life cycles, subcellular spore structure, and the manner of colonization of roots have been recognized (Mosse 1959, 1970). It has been found that some taxa formed in plant roots vesicular-arbuscular mycorrhizae, whereas the mycorrhizae of other species lacked vesicles. Still other species have either been associated with ectomycorrhizae in the field (Gerdemann and Trappe 1974) or have produced ectomycorrhizae in one-species cultures (Fassi 1965; Walker 1985). The first key to recognition of the types of the endogonaceous spores isolated has been prepared by Mosse and Bowen (1968).

In 1974, Gerdemann and Trappe revised the Endogonaceae. In the family Endogonaceae further maintained in the order Mucorales, 44 species in seven genera were characterized. Among them, many taxa were redefined, and two genera (Acaulospora, Gigaspora) and 12 species were described as new. The genus Endogone contained 11 species with zygospores arranged in sporocarps. Two of them, E. lactiflua Berk. & Broom and E. flammicorona Trappe & Gerd., have produced ectomycorrhizae (Fassi 1965; Gerdemann and Trappe 1974; Walker 1985). According to Gerdemann and Trappe (1974), the other Endogone species were ectomycorrhizal or saprotrophic fungi.

The genus Glomus with 19 species (then with two varieties of Gl. macrocarpus, i. e., Gl. macrocarpus var. macrocarpus and Gl. macrocarpus var. geosporus), originally erected by Tulasne and Tulasne (1845), and the genus Sclerocystis with four taxa contained species forming chlamydospores blastically at hyphal tips. In contrast to sporocarpic Sclerocystis spp., the chlamydospores of members of the genus Glomus have been considered to occur mainly in loose aggregates or singly in the soil, although the genus also included species forming compact sporocarps with or without a peridium. Species of the genus Glomus have been found to form vesicular-arbuscular or only arbuscular mycorrhizae.

The distinctive property of members of the genus Sclerocystis was the production of chlamydospores arranged in a single layer around a central, spore-free plexus.

The newly erected genera Acaulospora and Gigaspora have been defined by Gerdemann and Trappe (1974) as forming azygospores singly in the soil, although no parthenogenetical process of spore development was observed. Acaulospora spp. produced spores laterally on the neck of a sporiferous saccule, and species of the genus Gigaspora formed spores terminally at the tip of an inflated, bulbous sporogenous hypha.

The genera Glaziella and Modicella Kanouse were represented by chlamydosporic and sporangial species, respectively.

In 1979, Ames and Schneider erected a new genus in the Endogonaceae, Entrophospora with E. infrequens, a species earlier existing in the genus Glomus, as Gl. infrequens (Hall 1977). Spores of E. infrequens were formed inside the neck of a sporiferous saccule.

In the same year, Benjamin (1979) redefined the order Mucorales, remaining in it only fungi being mainly saprotrophs or nonhaustorial parasites that reproduce asexually by sporangia, sporangiola, merosporangia, and sometimes by chlamydospores, arthrospores, and yeast-like cells. Consequently, he transferred the family Endogonaceae to the order Endogonales erected by Moreau (1953).

In 1979, Walker proposed to establish a next genus in the Endogonaceae, Complexipes C. Walker with one species, C. moniliformis C. Walker. The ornamented Glomus-like spores of C. moniliformis were isolated from the root zone of Parthenocisus quinquefolia (L.) Planch. growing in a pine plantation. No properties of mycorrhizae of this fungus were recognized. The spores morphologically resembled “crenulate spores” found by Mosse and Bowen (1968) in New Zealand and Australia and those of the E-strain fungi associated with ectomycorrhizae of trees of the genus Pinus (Mikola 1965; Wilcox et al. 1974).

Danielson (1982) suggested C. moniliformis to belong to the Ascomycota. Young and Wilcox (1984) classified the E-strain fungi and C. moniliformis to a new species of the genus Tricharina Eckblad, T. mikolae Chin S. Yang & H.E. Wilcox (Discomycetes, Ascomycota). Subsequently, Yang and Korf (1985) segregated from the genus Tricharina a new taxon, Wilcoxina Chin S. Yang & Korf gen. nov. (Pezizales) with anamorphic chlamydospores of the E-strain fungi and C. moniliformis.

Since 1984, the genera Glaziella and Modicella were not considered to be members of the family Endogonaceae. The presence of septa in fragments of sporocarps of Glaziella aurantiaca (Berk. & Curtis) Cooke has decided that the fungus has first been transferred to Deuteromycotina (Gibson 1984) and then to a new order, Glaziellales Gibson with one family, Glaziellaceae Gibson (Gibson et al. 1986). The genus Modicella has been transferred to the Mortierellaceae (Trappe and Schenck 1982).

In 1986, Walker and Sanders separated from the genus Gigaspora, containing species with spores lacking an inner germination wall having no physical contact with their main, structural wall, the genus Scutellospora with fungi forming spores having at least one inner germination wall.

In 1990, Morton and Benny located soil-borne fungi forming arbuscules in roots of terrestrial plants in a new order, Glomales (orthographically corrected to Glomerales by Schü฿ler et al. 2001), consisting of two suborders, Glomineae J.B. Morton & Benny and Gigasporineae J.B. Morton & Benny. The former suborder consisted of the type family Glomaceae, with the genera Glomus and Sclerocystis, and the Acaulosporaceae fam. nov., containing the genera Acaulospora and Entrophospora. The latter suborder was proposed to include the Gigasporaceae fam. nov. with the genera Gigaspora and Scutellospora.

Apart from differences in the mode of formation of spores and their subcellular structure, the taxa of the suborder Glomineae distinguished the ability to form vesicles that did not occur in mycorrhizae of members of the suborder Gigasporineae.

Fungi of the genus Endogone remained in the family Endogonaceae Paol. emend. J.B. Morton & Benny of the order Endogonales Moreau ex R. K. Benj. emend. J.B. Morton & Benny containing fungi forming only zygospores in compact sporocarps.

In 1990, Almeida and Schenck concluded that, except for Sclerocystis coremioides, a continuum of morphological properties exists between sporocarpic Glomus species and the other members of the genus Sclerocystis. As a result, the five-species genus Sclerocystis was reduced to a single-species one.

In 2000, Redecker et al., utilizing both morphological and molecular data, transferred S. coremioides to the genus Glomus and, thereby, eliminated the genus Sclerocystis from the Kingdom Fungi.

In 2001, based on data from molecular, morphological and biochemical investigations, Morton and Redecker erected two new families in the order Glomales (now Glomerales), i. e., Archaeosporaceae and Paraglomaceae (now Paraglomeraceae). Each of these families was phylogenetically distant from each other and from other glomalean families, despite similarities in mycorrhizal morphology. The family Archaeosporaceae contained one genus, Archaeospora, with three species forming atypical Acaulospora-like spores from the neck of a sporiferous saccule. Two of these species, Ar. gerdemannii and Ar. leptoticha, were considered to dimorphic, forming Glomus-like spores as well. The genus Paraglomus in the family Paraglomaceae (now Paraglomeraceae) consisted of two species producing spores indistinguishable from those of Glomus species.

The classification of arbuscular fungi used in the website presented here is that of Schüßler et al. (2001) with emendations of Oehl and Sieverding (2004), Walker and Schüßler (2004), Sieverding and Oehl (2006), Spain et al. (2006), Walker et al. (2007a, b), and Palenzuela et al. (2008).

GLOMEROMYCOTA C. Walker & Schuessler
Glomeromycetes Cavalier-Smith
Archaeosporales C. Walker & Schuessler
Ambisporaceae C. Walker, Vestberg & Schuessler
        Ambispora Spain, Oehl & Sieverd.
Archaeosporaceae J.B. Morton & D. Redecker emend. Oehl & Sieverd.
        Archaeospora J.B. Morton & D. Redecker
Intraspora Oehl & Sieverd.
Geosiphonaceae Engler. & E. Gilg emend. Schuessler
Geosiphon (Kütz.) F. Wettst.
Diversisporales C. Walker & Schuessler
Acaulosporaceae J.B. Morton & Benny
Acaulospora Gerd. & Trappe emend. S.M. Berch
Kuklospora Oehl & Sieverd.
Acaulospora Gerd. & Trappe emend. S.M. Berch
Diversisporaceae C. Walker & Schuessler
Diversispora C. Walker & Schuessler
Otospora Oehl, J. Palenzuela & N. Ferrol
Entrophosporaceae Oehl & Sieverd.
Entrophospora R.N. Ames & R.W. Schneid. emend. Oehl & Sieverd.
Gigasporaceae J.B. Morton & Benny
Gigaspora Gerd. & Trappe emend. C. Walker & F.E. Sanders
Scutellospora C. Walker & F.E. Sanders
Pacisporaceae C. Walker, Blaszk., Schuessler & Schwarzott
Pacispora Oehl & Sieverd.
Glomerales J.B. Morton & Benny
Glomeraceae Piroz. & Dalpé
Glomus Tul. & C. Tul.
    Paraglomerales C. Walker & Schuessler
      Paraglomaceae J.B. Morton & D. Redecker
        Paraglomus J.B. Morton & D. Redecker

In this system of classification, fungi forming or considered to form arbuscular mycorrhizae are placed in four orders, i. e., Archaeosporales, Diversisporales, Glomerales, and Paraglomerales, comprising ten families and thirteen genera, belonging to the class Glomeromycetes of the phylum Glomeromycota (Oehl and Sieverding 2004; Palenzuela et al. 2008; Schüßler et al. 2001; Sieverding and Oehl 2006; Spain et al. 2006; Walker and Schüßler 2004; Walker et al. 2007a, b). Geosiphon pyriformis of the family Geosiphonaceae (Archaeosporales) does not form arbuscular mycorrhizae. It forms endocytosymbioses with cyanobacteria (Noctos sp.) and was included into the Glomeromycota based on only its close molecular relationship.

Molecular investigations showed that fungi of the phylum are more closely related to members of the phyla Ascomycota and Basidiomycota than to those of the phylum Zygomycota, as, e. g., Gerdemann and Trappe (1974), Lawrynowicz (1979), and Morton and Benny (1990) earlier believed.

The fungi of the order Archaeosporales form endocytosymbioses with photoautotrophic prokaryotes (Geosiphon pyriformis) or produce mycorrhizae with arbuscules, with or without vesicles. Their spores are colourless and do not react in Melzer’s reagent. Glomoid spores (identical to those of fungi of the genus Glomus) form singly or in clusters on or under the soil surface. Acaulosporioid spores (similar to those of members of the genus Acaulospora) develop singly in the soil. The fungi differ from other arbuscular fungi by the possession of the rRNA SSU gene signature YCTATCYKYCTGGTGAKRCG, corresponding to homologous position 691 of the Saccharomyces cerevisiae SSU r RNA sequence J01353, with the coloured nucleotides being specific for the taxon. The order Archaeosporales contains three families, Archaeosporaceae with the genera Archaeospora and Intraspora, Ambisporaceae with the genus Ambispora, and Geosiphonaceae with the genus Geosiphon.

Members of the order Diversisporales form mycorrhizae with arbuscules, frequently lacking vesicles, with or without auxiliary cells. Spores develop either inside (entrophosporioid spores of the genera Entrophospora and Kuklospora) or laterally on the neck of a sporiferous saccule (acaulosporioid spores of the genus Acaulospora and Otospora), from a bulbous base on the sporogenous hypha (gigasporioid spores of the genera Gigaspora and Scutellospora), or blastically at the tip of a sporogenous hypha (glomoid spores of the genera Diversispora and Pacispora). They differ from other arbuscular fungi by the possession of the rRNA SSU gene sequence signature YVRRYW/1-5/NGYYYGB, corresponding to homologous position 658 of the S. cerevisiae SSU rRNA sequence J01353 SSU rRNA, GTYARDYHMHYY/2-4/GRADRKKYGWCRAC, corresponding to homologous position of the S. cerevisiae SSU rRNA sequence position 1346 of the S. cerevisiae SSU rRNA sequence J01353, TTATCGGTTRAATC, corresponding to homologous position 650 of the S. cerevisiae rRNA SSU sequence J01353, and ACTGAGTTMATYT, corresponding to homologous position 1481 of the S. cerevisiae rRNA SSU sequence J01353 with the coloured nucleotides being specific for the taxon. The order Diversisporales is represented by five families, Diversisporaceae with the genera Diversispora and Otospora , Acaulosporaceae with the genera Acaulospora and Kuklospora, Entrophosporaceae with the genus Entrophospora, Gigasporaceae with the genera Gigaspora and Scutellospora, and Pacisporaceae with the genus Pacispora.

Fungi of the order Glomerales usually are hypogeous, rarely epigeous. They produce mycorrhizae with arbuscules, vesicles, and spores. Spores form either blastically at the tip of a sporogenous hypha or intercalary inside them. Spores occur singly, in clusters or sporocarps having a peridium. They differ from other arbuscular fungi by the possession of the rRNA SSU gene sequence signature YTRRY/2-5/RYYARGTYGNCARCTTCTTAGAGGGACTATCGGTGTYTAACCGRTGG, corresponding to homologous position 1353 of the S. cerevisiae SSU rRNA sequence J J01353, with the coloured nucleotides being specific for the taxon. The order Glomerales includes one genus, Glomus.

Species of the order Paraglomerales form arbuscular mycorrhizae, rarely with vesicles. Spores are glomoid and colourless. The fungi differ from other arbuscular fungi by the possession of the rRNA SSU gene sequence signature GCGAAGCGTCATGGCCTTAACCGGCCGT, corresponding to homologous position 703 of the S. cerevisiae SSU rRNA sequence J01353, with the coloured nucleotides being specific for the taxon. The order Paraglomerales is represented by one family, Paraglomeraceae, containing one genus, Paraglomus.

At present, the number of described species of arbuscular fungi is ca. 200. According to Morton et al. (1994), the number of species of this group of fungi may come up to 2700.


Almeida R. T., Schenck N. C. 1990. A revision of the genus Sclerocystis (Glomaceae, Glomales). Mycologia 82, 703-714.

Ames R. N., Schneider R. W. 1979. Entrophospora, a new genus in the Endogonaceae. Mycotaxon 8, 347-352.

Benjamin R. K. 1979. Zygomycete and their spores. In: Kendrick B. (ed.). The whole fungus. Vol. II. National Museums of Canada. Ottawa, Canada, 573-622.

Danielson R. M. 1982. Taxonomic affinities and criteria for identification of the common ectendomycorrhizal symbiont of pines. Can. J. Bot. 60, 7-18.

Fassi B. 1965. Micorrhize ectotrofiche di Pinus strobus L. prodotte da un’ Endogone (Endogone lactiflua Berk.). Allionia 11, 7-15.

Gerdemann J. W., Trappe J. M. 1974. The Endogonaceae in the Pacific Northwest. Myc. Memoir. 5, 1-76.

Gibson J. L. 1984. Glaziella aurantiaca (Endogonaceae) zygomycete or ascomycete? Mycotaxon 20, 325-328.

Gibson J. L. Kimbrough J. W., Benny G. L. 1986. Ultrastructural observations on Endogonaceae (Zygomycetes). II. Glaziellales ord. nov. and Glaziellaceae fam. nov.: new taxa based upon light and electron microscopic observations of Glaziella aurantiaca. Mycologia 78, 941-954.

Godfrey R. M. 1957. Studies of British species of Endogone. I. Morphology and taxonomy. Trans. Br. Mycol. Soc. 40, 117-135.

Hall I. R. 1977. Species and mycorrhizal infections of New Zealand Endogonaceae. Trans. Br. Mycol. Soc. 68, 341-356.

Lawrynowicz M. 1979. Endogonales, klebiankowate. In: Skirgiello A., Zadara M., Lawrynowicz M. Grzyby X. Warszawa-Kraków, 273-295.

Mikola P. 1965. Studies on the ectendotrophic mycorrhiza of pine. Acta For. Fenn. 75, 1-56.

Moreau F. 1953. Les Champignons. Tome II. Systematique. Encycl. Mycol. 23, 941-2120. Paul Lechevalier, Paris.

Morton J. B., Benny G. L. 1990. Revised classification of arbuscular mycorrhizal fungi (Zygomycetes): a new order, Glomales, two new suborders, Glomineae and Gigasporineae, and two new families, Acaulosporaceae and Gigasporaceae, with an emendation of Glomaceae. Mycotaxon 37, 471-491.

Morton J. B., Redecker D. 2001. Two families of Glomales, Archaeosporaceae and Paraglomaceae, with two new genera Archaeospora and Paraglomus, based on concordant molecular and morphological characters. Mycologia 93, 181-195.

Morton J. B., Bentivenga S. P., Bever J. D. 1994. Discovery, measurement, and interpretation of diversity in arbuscular endomycorrhizal fungi (Glomales, Zygomycetes). Can. J. Bot. 73(Suppl. 1), S25-S32.

Mosse B. 1959. The regular germination of resting spores and some observations on the growth requirements of an Endogone sp. causing vesicular-arbuscular mycorrhiza. Trans. Br. Mycol. Soc. 42, 273-286.

Mosse B. 1970. Honey-coloured, sessile Endogone spores. I. Life history. Arch. Microbiol. 70, 167-175.

Mosse B., Bowen G. D. 1968. A key to the recognition of some Endogone spore types. Trans. Br. Mycol. Soc. 51, 469-483.

Oehl F., Sieverding E. 2004. Pacispora, a new vesicular arbuscular mycorrhizal fungal genus in the Glomeromycetes. J. Appl. Bot. 78, 72-82.

Sieverding E., Oehl F. 2006. Revision of Entrophospora and description of Kuklospora and Intraspora, two new genera in the arbuscular mycorrhizal Glomeromycetes. J. Appl. Bot. Food Qual. 80, 69-81.

Spain J. L., Sieverding E., Oehl F. 2006. Appendicispora: a new genus in the arbuscular mycorrhiza-forming Glomeromycetes, with a discussion of the genus Archaeospora. Mycotaxon 97, 163-182.

Palenzuela J., Ferrol N., Boller T., Azcón-Aguilar C., Oehl F. 2008. Otospora bareai, a new fungal species in the Glomeromycetes from a dolomitic shrubland in the Natural Park of Sierra de Baza (Granada, Spain). Mycologia (in press).

Peyronel B. 1923. Fructification de l’endophyte à vésicules des mycorrhizes endotrophes. Bull. Soc. Myc. de France 39.

Redecker D., Morton J. B., Bruns T. D. 2000. Molecular phylogeny of the arbuscular mycorrhizal fungi Glomus sinuosum and Sclerocystis coremioides. Mycologia 92, 282-285.

Schüßler A. 2002. Molecular phylogeny, taxonomy, and evolution of Geosiphon pyriformis and arbuscular mycorrhizal fungi. Plant and Soil 244, 75-83.

Schüßler A., Schwarzott D., Walker C. 2001. A new fungal phylum, the Glomeromycota: phylogeny and evolution. Myc. Res. 105, 1413-1421.

Thaxter R. 1922. A revision of the Endogonaceae. Proc. Am. Acad. Arts Sci. 57, 291-351.

Trappe J. M., Schenck N. C. 1982. Taxonomy of the fungi forming endomycorrhizae. In: Schenck N. C. (ed.). Methods and principles of mycorrhizal research. Amer. Phytopath. Soc. St. Paul., MN, 1-9.

Tulasne L. R., Tulasne C. 1845. Fungi nonnulli hypogaei, novi minus cogniti act. Giorn. Bot. Ital. 2, 35-63.

Walker C. 1985. Endogone lactiflua forming ectomycorrhizas with Pinus contorta. Trans. Br. Mycol. Soc. 84, 353-355.

Walker C. 1979. Complexipes moniliformis: a new genus and species tentatively placed in the Endogonaceae. Mycotaxon 10, 99-104.

Walker C., Sanders F. E. 1986. Taxonomic concepts in the Endogonaceae: III. The separation of Scutellospora gen. nov. from Gigaspora Gerd. & Trappe. Mycotaxon 27, 169-182.

Walker C., Schüßler A. 2004. Nomenclatural clarifications and new taxa in the Glomeromycota. Mycol. Res. 108, 979-982.

Walker C., Vestberg M., Demircik F., Stockinger H., Saito M., Sawaki H., Nishmura I., Schüßler A. 2007. Molecular phylogeny and new taxa in the Archaeosporales (Glomeromycota): Ambispora fennica gen. sp. nov., Ambisporaceae fam. nov., and emendation of Archaeospora and Archaeosporaceae. Mycol. Res. 111, 137-13.

Walker C., Vestberg M., Schü฿ler A. 2007. Nomenclatural clarifications in Glomeromycota. Mycol. Res. 111, 253-255.

Wilcox H. E., Ganmore-Neumann R., Wang C. J. K. 1974. Characteristics of two fungi producing ectendomycorrhizae in Pinus resinosa. Can. J. Bot. 52, 2279-2282.

Yang C. S., Korf R. P. 1985. A monograph of the genus Tricharina and of a new segregate genus, Wilcoxina (Pezizales). Mycotaxon 24, 467-531.

Yang C. S., Wilcox H. E. 1984. An E-strain ectendomycorrhiza form by a new species, Tricharina mikolae. Mycologia 76, 675-684.

Zycha H. 1935. Mucorineae. Kryptogamenfl. Mark Brandenburg 6a, Leipzig, 264 pp.